If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang 150081, China
Yu Bian, Department of Pharmacology, The State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Harbin Medical University, 157 Baojian Rd, Nangang District, Harbin, Heilongjiang, 150081, China
Cardiac fibrosis is a common pathological change in the development of heart disease. Circular RNA (circRNA) has been shown to be related to the occurrence and development of various cardiovascular diseases. This study aimed to evaluate the effects and potential mechanisms of circHelz in cardiac fibrosis. Knockdown of circHelz alleviated cardiac fibrosis and myocardial fibroblast activation induced by myocardial infarction (MI) or angiotensin II (AngII) in vivo and transforming growth factor-β (TGF-β) in vitro. Overexpression of circHelz exacerbated cell proliferation and differentiation. Mechanistically, nuclear factor of activated T cells, cytoplasmic 2 (NFATc2) was found to act as a transcriptional activator to upregulate the expression of circHelz. The increased circHelz was demonstrated to bind to Yes-associated protein (YAP) and facilitate its localization in the nucleus to promote cell proliferation and growth. Moreover, silencing YAP1 reversed the detrimental effects caused by circHelz in vitro, as indicated by the observed decreases in cell viability, fibrotic marker expression levels, proliferation and migration. Collectively, the protective effect of circHelz knockdown against cardiac fibrosis injury is accomplished by inhibiting the nuclear translocation of YAP1. Thus, circHelz may be a novel target for the prevention and treatment of cardiovascular disease.
Cardiac fibrosis is a common pathological change in the development of heart disease. Circular RNA (circRNA) has been found to be related to the occurrence and development of various cardiovascular diseases. However, the relationship between cardiac fibrosis and circRNA still needs to be further explored.
Translational Significance
Translational Significance: We found that the upregulation of circHelz boosted cardiac fibrosis through binding to YAP1 and facilitated YAP1 localization in the nucleus. Thus, circHelz may be a novel target for the prevention and treatment of cardiovascular disease.
INTRODUCTION
Cardiac fibrosis, an independent predictor of total mortality, is distinguished by the immoderate activation of cardiac fibroblasts and excessive deposition of extracellular matrix (ECM), which can contribute to the emergence and progression of cardiovascular diseases, encompassing myocardial infarction and heart failure.
When the heart is exposed to undesirable stimuli and impairment, myofibroblasts derived from fibroblast replacement of necrotic cardiomyocytes facilitate cardiac remodeling and retain the structural integrity of the heart cavity by generating ECM proteins represented by type I collagen and type III collagen.
Nevertheless, the compliance of cardiac tissues pronouncedly decreases owing to abnormal ECM accumulation, which is difficult to absorb, thus deepening cardiac dysfunction and aggravating the stiffness of cardiac chambers.
Since remedial operative approaches are currently unavailable, it is important to detect new targets to ameliorate cardiac fibrosis.
Circular RNAs (circRNAs), characterized by a novel covalently closed loop, arise from back-splicing of precursor mRNA transcripts. CircRNAs boast the functions of high stability due to the absence of 5–3 polarity or a polyadenylation tail and are difficult to hydrolyze by exonucleases.
CircRNAs, also called competitive endogenous RNAs, are known to function as microRNA sponges to adjust and control downstream gene expression and can also impact biological processes by constructing complexes with RNA-binding proteins or by acting as protein translation templates.
Wu et al. reported that the circular RNA mmu_circ_0005019 inhibits the activation of cardiac fibroblasts and reverses the electrical remodeling of cardiomyocytes.
However, the relationships between circRNAs and cardiac fibrosis and the regulatory mechanism of circRNAs in heart disease still need to be further explored.
The existing research has elucidated the signal transduction pathways implicated in the occurrence of cardiac fibrosis, including the JAK2/STAT3 and TGF-β1/SMAD2/3 signaling pathways.
Hippo-YAP, a highly evolutionarily conserved kinase signaling cascade, was initially discovered in Drosophila and has a consequential impact on tissue homeostasis, cardiomyocyte proliferation, self-renewal of stem cells and cardiac development.
When the hippo pathway is deactivated, Yes-associated proteins (YAP) induce gene expression and further promote cell proliferation, migration and anti-apoptosis activity by entering the nucleus and interacting with TEA domain transcription factors; in contrast, YAP proteins phosphorylated by associated kinases are degraded secondary to cytoplasmic localization.
Therefore, the upstream mechanism of YAP in cardiac fibrosis is worthy of further exploration.
In our previous study, we identified a circRNA that originates from the exons of the coding gene helicase with zinc finger (Helz), named circHelz (mmu_circ_0000332), which is involved in the regulation of acute myocardial infarction.
This finding prompted us to explore the effect of circHelz on cardiac fibrosis in myocardial infarction or AngII infusion mice. Moreover, we aimed to ascertain how this novel circRNA is correlated with the Hippo-YAP signaling pathway. Our results indicate that circHelz promotes the nuclear translocation of YAP1 by binding to it and that silencing circHelz can reverse the increased YAP1 protein expression caused by myocardial injury. Hence, circHelz may be expected to serve as an underlying target for treatment of cardiovascular disease.
MATERIALS AND METHODS
Mouse model of MI and AngII infusion
This investigation was authorized by the Institutional Animal Care and Use Committee of Harbin Medical University (IRB3006217). All experimental procedures were executed in compliance with the NIH Guide for the Care and Use of Laboratory Animals. Briefly, the left anterior descending coronary artery (LAD) of eight-week-old male C57BL/6 mice was ligated with 7–0 nylon at 1–2 mm below the left atrium for 28 days. In sham mice, the LAD was passed through with sutures but not ligated. Eventually, echocardiography was used to evaluate cardiac function, and subsequently, serum and heart tissues were stored at -80°C.
For AngII infusion mice, alzet osmotic mini-pumps (Alzet 2006; Durect Corporation, California, 0.15 μl/h) infusing AngII (A9525, Sigma-Aldrich Corporation, Missouri, 25 mg/ml) were implanted subcutaneously in the dorsal region. After the pump was submerged for 8 weeks, the Ang II pumps were not replaced, heart was harvested for further experiments.
Construction of AAV9 and ADV viral vectors
On the one hand, an AAV9 (1.6 × 1011 particles/animal) vector carrying a short hairpin RNA fragment to silence circHelz, or a negative control, both bound to a green fluorescent protein (Hanbio Biotechnology, China), were constructed and injected into mice via tail vein only once before surgery. The shRNA sequence was 5’-TGGAAGGTGTAGTGCTGGG-3’, and the antisense sequence was 5’-CCCAGCACTACACCTTCCA-3’. On the other hand, circHelz-carrying adenovirus for overexpression (circHelz-V) and empty vector-carrying adenovirus (NC-V) were constructed by Hanbio Biotechnology.
Echocardiographic analysis
Mice were abdominal injection anesthetized with 2% avertin (0.1 ml/10 g body weight). M-mode echocardiography was detected using a Vevo2100 echocardiographic system (Visualsonics, Toronto, Ontario, Canada) at a probe frequency of 10 MHz. To obtain the left ventricular internal dimension at end-diastole (LVIDd) and the left ventricular internal dimension at systole (LVIDs), a noninvasive ultrasound beam was used to measure the maximal and minimal diameters of the left ventricle. After measuring an average of at least 3 consecutive cardiac cycles, the ejection fraction (EF) and fractional shortening (FS) were precisely acquired.
Masson's trichrome staining
The dissected hearts were immersed in 4% paraformaldehyde and dehydrated. According to the manufacturer's instructions, a Masson's Trichrome Staining kit (Solarbio, Beijing, China) was used to examine fibrosis. Eventually, the extent of collagen deposition was calculated using image analysis software, and the percentage of the fibrotic area was observed and marked.
Hydroxyproline (HYP) content determination
According to the manufacturer's instructions, an HYP assay kit (Jiancheng Biotechnique Institute, China) was used to measure HYP content in serum and myocardium.
Cell culture
Cardiac fibroblasts (CFs) were isolated from 1 to 3-day-old mice and digested in a solution containing trypsin (Solarbio, Beijing, China) and DMEM for 8–12 hour on a 4°C shaker. The cardiac specimens were then dispersed in collagenase type II (Thermo Fisher Scientific, Waltham, Massachusetts), and the lysates were collected. The cells were centrifuged and resuspended in DMEM supplemented with 5% fetal bovine serum (Biological Industries, Haemek, Israel) and 0.8% penicillin and streptomycin (Beyotime, Shanghai, China) followed by incubation in a 5% CO2 incubator at 37°C for 1.5 hour. Ultimately, nonadherent cardiomyocytes were removed from the cell culture dishes, and CFs were obtained for required experiments.
CFs were isolated from male adult C57BL/6 mice. First, after removal of the atrium and large blood vessels from the heart, the ventricles were cut into 3 pieces of 1 mm, followed by digestion with 100% (w/v) trypsin (Solarbio, Beijing, China) and 50% (w/v) collagenase type II at 37°C and addition of DMEM containing 10% FBS to terminate digestion. Subsequently, these steps were repeated until the tissues disappeared completely and the cells were constantly being collected. Ultimately, the cells were centrifuged and resuspended in DMEM containing 10% FBS, followed by incubation in a 5% CO2 incubator at 37°C for further experiments.
Cell transfection and treatment
When the first generation of fibroblasts adhered to the wall and the density was about 80%, the cells were transfected with plasmids or siRNA using Lipofectamine 3000 reagent (Invitrogen, Carlsbad) and X-treme gene siRNA transfection reagent (Roche, Basel, Switzerland), respectively. YAP1-specific small interfering RNA (si-YAP1) and a negative control siRNA (si-NC) were purchased from RiboBio (Guangzhou, China). CircHelz siRNA sequences were chemically synthesized by GenePharma (Shanghai, China). The sequences of mouse si-circHelz were sense 5’-UGGAAGGUGUAGUGCUGGGTT-3’ and antisense 5’-CCCAGCACUACACCUUCCATT-3’. The sequences of mouse si-YAP1 were sense 5’-CGAGAUGAGAGCACAGACATT-3’ and antisense 5’-UGUCUGUGCUCUCAUCUCGTT-3’. The sequences of mouse si-NFATc2 were sense 5’-GCUACGGAUUGAGGUCCAATT-3’ and antisense 5’-UUGGACCUCAAUCCGUAGCTT-3’. CFs were transfected with siRNAs at a final concentration of 50 nM, and Lipofectamine 3000 and X-treme were used according to the manufacturer's instructions. After transfection with serum starvations for 6–8 hour, TGF-β1 (10 ng/ml; Peprotech, Rocky Hill, New Jersey) was added to a DMEM medium without serum for 48 hour. For co-transfection experiment, the circHelz adenovirus was added into fibroblasts to overexpress circHelz. After 24 hours, si-NC or si-YAP1 was transfected into each group.
Cell viability determined by CCK8 assays
CFs were cultured in 96-well plates, followed by incubation in 100 µl medium containing 10 µl of CCK8 solution (Beijing Labgic Technology Co., Ltd, Beijing, China) per well for 1.5–2 hour in the dark. To assess cell viability, the absorbance was measured at OD 450 nm in a colorimetric microplate reader.
Wound healing assay
Three straight lines per well were vertically drawn in CF cultures with a sterilized white tip. Then, the cultures were washed, the medium was replaced with new serum-free medium, and the cells were photographed. The cells were transfected with NC or si-circHelz, as well as TGF-β treatments, then wounds were imaged at 0 and 72 hours. In addition, the cells were transfected with NC-V and circHelz-V, then wounds were imaged at 0 and 48 hours. Furthermore, the cells were transfected with circHelz-V and NC or si-YAP1, then wounds were imaged at 0 and 72 hours. All wounds were imaged by an inverted microscope.
EdU (5-ethynyl-2′-deoxyuridine) staining
CFs were treated with 300 μl EdU medium that included 10 μmol/l EdU reagent from an EdU kit (RiboBio, Guangzhou, China) for 24 hours. After washing, the cells were fixed, decolored, and permeated with 300 μl 0.5% Triton X-100. Finally, the cells were treated with Apollo and subjected to DNA staining. Under a fluorescence microscope, the results were observed and photographed.
Immunofluorescence
Cells or tissues were fixed and penetrated. After blocking with 10% normal goat serum at 37°C for 1 h, YAP1 (#13584-1-AP, Proteintech, Wuhan, China, 1:200) or α-SMA (#AF1032, Affinity Biosciences, Changzhou, China, 1:500) antibodies were incubated with the samples at 4°C overnight. Then, the samples were rinsed with PBS 3 times and incubated with fluorescent secondary antibody (1:500) for 1 hour in the dark. Then, DAPI (Beyotime Institute of Biotechnology, Shanghai, China) was added to stain the nuclei for 5–8 minute, and the cells were placed under a laser scanning confocal microscope for observation and image acquisition.
Fluorescence in situ hybridization (FISH)
An oligonucleotide-modified probe sequence for circHelz was synthesized by GENESEED (Guangzhou, China). The handled cells were washed, fixed and permeated. According to the manufacturer's instructions, fluorescence was assessed using a Ribo Fluorescent In Situ Hybridization Kit. The cells were treated with prehybridization buffer, hybridization buffer and probe hybridization buffer in sequence and incubated overnight at 37°C, followed by DAPI to stain the nuclei. Fluorescence was assessed under a laser scanning confocal microscope, and total fluorescence intensity was analyzed using ImageJ.
Western blot
Total proteins were extracted with lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China) containing protease inhibitors (Roche, Switzerland) and phosphatase inhibitors (Roche, Basel, Switzerland). A nuclear and cytoplasmic extraction kit (Thermo Scientific Pierce, 78,835) was used to extract the nuclear and cytoplasmic proteins. Next, a bicinchoninic acid (BCA) protein kit (Beyotime Institute of Biotechnology, Shanghai, China) was used to measure the protein concentrations. Proteins were separated by sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE) and transferred to nitrocellulose membranes. Subsequently, the membranes were blocked and then incubated with primary antibodies against β-actin (#bs-0061R, BIOSS, Beijing, China, 1:1000), GAPDH (#TA-08, ZsBio, Beijing, China, 1:1000), Lamin B1 (#A11495, ABclonal, Wuhan, China, 1:500), NFATc2 (#22023-1-AP, Proteintech, Wuhan, China, 1:500) and YAP1 (#13584-1-AP, Proteintech, Wuhan, China, 1:1000) at 4°C overnight. After incubation with horseradish peroxidase-labeled anti-rabbit/mouse IgG (1:10000, LI-COR Bioscience, Lincoln) in the dark for 50 minute at room temperature, the protein bands were quantified using an Odyssey infrared imaging system (LI-COR, Lincoln, Nebraska). GAPDH/β-actin/Lamin B1 were used as internal controls.
RNA isolation and qRT‒PCR
TRIzol (Invitrogen, Carlsbad, California) was used to extract total RNA. RNA was reversely transcribed to cDNA using a Reverse Transcription kit (Toyobo, Japan). SYBR Green Master Mix (Toyobo, Japan) was used to quantify circHelz, Helz, Col1a1, Col3a1, CTGF, α-SMA, YAP1 and NFATc2 RNA levels. GAPDH or 18S was used as an internal control. The following primers were used in this study: GAPDH-forward 5’-AAGAAGGTGGTGAAGCAGGC-3’ and GAPDH-reverse 5’-TCCACCACCCTGTTGCTGTA-3’; 18S-forward 5’-CCTGGATACCGCAGCTAGGA-3’ and 18S-reverse 5’-GCGGCGCAATACGAATGCCCC-3’; circHelz- forward 5’-CCCTGTTGCTCTGTGCTCTA-3’ and circHelz-reverse 5’-GATGGAGGACACAAGCTGGA-3’; Helz-forward 5’- TGGAGGTTGAGCGCATCAAAA -3’ and Helz-reverse 5’- ATCCCATTCAGAGACTCCCCT -3’; Col1a1-forward 5’-GCTCCTCTTAGGGGCCACT-3’ and Col1a1-reverse 5’- CCACGTCTCACCATTGGGG-3’; Col3a1-forward 5’-ACGTAGATGAATTGGGATGCAG-3’ and Col3a1-reverse 5’- GGGTTGGGGCAGTCTAGTG-3’; CTGF-forward 5’-ACTGGTGCAGCCAGAAAG-3’ and CTGF-reverse 5’-GCATCTCCACCCGAGTTAC-3’; α-SMA-forward 5’-GACGCTGAAGTATCCGATAG-3’ and α-SMA-reverse 5’-CCACACGAAGCTCGTTATAG-3’; YAP1-forward 5’-TTCGGCAGGCAATACGGAAT-3’ and YAP1-reverse 5’-CATCCTGCTCCAGTGTAGGC-3’; NFATc2-forward 5’-TCATCCAACAACAGACTGCCC-3’ and NFATc2-reverse 5’-GGGAGGGAGGTCCTGAAAACT-3’.
Actinomycin D and RNase R treatment
The cells were treated with actinomycin D (Act D) (5 μg/ml, MedchemExpress, New Jersey) and DMSO (Biofroxx, Germany) to block transcription and collected at the indicated time points. Total RNA (1 μg) was incubated with 1 U of RNase R (Epicenter, Wisconsin) at 37°C for 10 minute. After treatment with actinomycin D or RNase R, the RNA expression levels of circHelz and GAPDH were analyzed via qRT‒PCR.
RNA-binding protein immunoprecipitation (RIP) assay
A RIP Kit (Millipore, Massachusetts) was used to perform the RIP assay according to the manufacturer's protocol. In brief, whole hearts were lysed in RIP lysis buffer on a 4°C shaker for 5 minute and then incubated with 50 μl of Protein-A/G agarose beads (Roche), followed by antibodies against YAP1 or IgG, with rotation overnight. The immune complexes were briefly centrifuged, and then, RIP washing buffer was used to rinse the beads 6 times. After RNA purification, the final products were subjected to qRT‒PCR analysis.
Luciferase reporter assay
Cells were transfected with the 5 plasmids containing the Helz promoter. According to the manufacturer's protocol, the cells were collected and lysed for luciferase assays using a Dual-Luciferase Reporter Assay System (Promega, Wisconsin). The ratio between firefly and Renilla luciferase activities was detected to evaluate the relative luciferase activity. Renilla luciferase activity was used as an internal control.
Chromatin immunoprecipitation (ChIP) assay
According to the manufacturer's instructions, the binding capacity between the Helz promoter and NFATc2 was assessed using a Pierce Agarose ChIP Kit (Thermo Scientific, Carlsbad, California). In brief, the cells were fixed and lysed, followed by ultrasonication to shear them into appropriate fragments. Then, the obtained chromatin was incubated with specific antibodies or isotype-matched control IgG overnight. After washing with wash buffer, the complexes were eluted and purified. Finally, the purified DNA was isolated and measured via qRT‒PCR.
Statistical analysis
All data are presented as the means ± SEMs of at least 3 independent experiments. Student's unpaired two-tailed t test was used for 2-group comparisons, and one-way analysis of variance (ANOVA) followed by Dunnett's corrected post hoc correction was used for multigroup comparisons. Analyses were performed using GraphPad Prism 9.0 software (GraphPad Software, San Diego, California). A P value < 0.05 was considered statistically significant.
RESULTS
Upregulation of circHelz in mouse MI hearts and TGF-β-treated CFs
Recently, we verified that the expression of circHelz was obviously increased in the myocardium of mice with MI (24 hour post-MI).
Here, we first detected its expression changes under fibrotic stimuli in vivo and in vitro and found that circHelz was significantly elevated in heart tissue 4 weeks after MI and in TGF-β-treated CFs isolated from neonatal and adult mice (Fig 1, A–C). In addition, we reconfirmed the circular nature of circHelz via Sanger sequencing and RNase R and Act D experiments (Fig 1, D, Supplementary Fig 1, A and B). Furthermore, circHelz was found to be located in the nucleus and cytoplasm, and the fluorescence intensity of circHelz was markedly increased in TGF-β-treated CFs, as determined by FISH staining (Fig 1, E and F).
Fig 1CircHelz is significantly upregulated in MI and activated CFs. (A) The RNA level of circHelz in MI mice. n = 6 mice per group. ⁎⁎P < 0.01 vs Sham. (B) The relative expression level of circHelz in TGF-β-treated CFs derived from neonatal mice was analyzed by qRT‒PCR. n = 4 individual experimental replicates. ⁎⁎P < 0.01 vs Ctrl. (C) The expression level of circHelz in CFs obtained from male adult C57BL/6 mice. n = 3 individual experimental replicates. ⁎⁎P < 0.01 vs Ctrl. (D) Sanger sequencing verified the generation of circHelz from its host gene. (E and F) The subcellular localization of circHelz was detected by a FISH assay in cultured CFs obtained from neonatal mice. Cell nuclei were stained with DAPI. 18S, U6 and circHelz were stained with Cy3. Scale bar = 20 µm. n = 4 individual experimental replicates. *P < 0.05 vs Ctrl.
Silencing circHelz is essential to alleviate cardiac function and cardiac fibrosis in MI mice
We then conducted a loss-of-function experiment in which circHelz was knocked down in mouse hearts by an AAV9 vector carrying a sequence fragment (sh-circHelz) and investigated whether silencing circHelz could affect cardiac function in MI mice (Fig 2, A). qRT‒PCR confirmed that circHelz was successfully knocked down, and deletion of circHelz did not affect the level of Helz in the myocardium (Supplementary Fig 2, A and B). Next, we found that the heart weight-to-body weight (HW/BW) ratio was obviously upregulated in MI mice; however, sh-circHelz reversed this abnormal phenomenon (Fig 2, B). Furthermore, echocardiographic assessment demonstrated that MI prominently induced a greater reduction in EF and FS and more LVIDd and LVIDs enlargement, all of which were improved by silencing circHelz (Fig 2, C–G). When MI occurs, a large number of cardiomyocytes die suddenly due to ischemia and hypoxia, which in turn triggers inflammation and activates myofibroblast repair, leading to scarring and myocardial fibrosis.
Using Masson's trichrome staining, which dyes collagen fibers blue, compared with red myocardial fibers, we observed that MI mice exhibited more blue areas than sham mice; however, MI mice with circHelz knockdown showed a remarkable reduction in blue areas (Fig 2, H). To further assess the antifibrotic effect of sh-circHelz in MI mice, we tested the HYP content, which is one of the main components of collagen tissue and reflects the collagen content.
The results demonstrated that the increased level of HYP caused by MI was nearly abolished by silencing circHelz in serum and myocardial tissue (Fig 2, I, Supplementary Fig 2, C). In the infarcted heart, the conversion of fibroblasts to myofibroblasts results in the expression of type I collagen (the most abundant protein in the cardiac extracellular matrix),
type III collagen, CTGF (a growth factor that stimulates fibroblast proliferation and collagen deposition) and α-smooth muscle actin (a contractile protein),
whereas inhibition of circHelz abrogated these detrimental changes (Fig 2, J–M). Immunofluorescence data also showed that the upregulated level of α-SMA in MI mice, presenting as a large area of red fluorescence, was significantly reduced by sh-circHelz compared with the level in the sham group, (Fig 2, N). Collectively, these results indicate that circHelz knockdown protects cardiac function and defends against fibrosis in response to MI injury.
Fig 2Inhibition of circHelz mitigates cardiac fibrosis in MI mice. (A) Schematic diagram of MI after AAV9 vector carrying an NC-shRNA or circHelz-shRNA fragment was injected into the mouse heart via the tail vein, and then, the heart was harvested at the corresponding time point. (B) The ratio of heart weight to body weight in each group. Sham+NC, n = 6 mice; MI+NC, MI+sh-circHelz, n = 7 mice. *P < 0.05 vs Sham+NC; #P < 0.05 vs MI+NC. NC or sh-circHelz represents the AAV9 vector carrying an NC-shRNA or circHelz-shRNA fragment. (C–G) Representative echocardiographs and statistics for determination of EF (%), FS (%), LVID;d (mm) and LVID;s (mm). n = 6 mice per group. ⁎⁎P < 0.01 vs Sham+NC; #P < 0.05, ##P < 0.01 vs MI+NC. (H) Masson staining was used to identify the level of fibrosis in myocardial tissue. The Masson trichrome-stained area is shown in blue. Scale bar = 500 μm. Sham + NC, MI+NC, n = 7 mice; MI+sh-circHelz, n = 6 mice. ⁎⁎P < 0.01 vs Sham+NC; ##P < 0.01 vs MI+NC. (I) The level of HYP (μg/mg) in myocardial tissue was measured to reflect the metabolism of collagen tissue and the degree of fibrosis. n = 5 mice per group. ⁎⁎P < 0.01 vs Sham+NC; ##P < 0.01 vs MI+NC. (J and K) The mRNA expression levels of fibrosis-related genes in each group. n = 6 mice per group. ⁎⁎P < 0.01 vs Sham+NC; ##P < 0.01 vs MI+NC. (L) The relative mRNA level of α-SMA in hearts was analyzed by qRT‒PCR. n = 5 mice per group. ⁎⁎P < 0.01 vs Sham+NC; #P < 0.05 vs MI+NC. (M) Relative mRNA level of CTGF in heart was analyzed by qRT‒PCR. n = 6 mice per group. ⁎⁎P < 0.01 vs Sham+NC; #P < 0.05 vs MI+NC. (N) Immunofluorescence analysis of α-SMA expression (red) in heart tissues. DAPI (blue) was used to stain nuclei. Scale bar = 20 μm. n = 4 mice per group (Color version of figure is available online.)
DKK3 overexpression attenuates cardiac hypertrophy and fibrosis in an angiotensin-perfused animal model by regulating the ADAM17/ACE2 and GSK-3beta/beta-catenin pathways.
we sought to examine whether deletion of circHelz could abate myocardial fibrosis in AngII infusion mice as in the MI model (Fig 3, A). First, we determined the expression of circHelz and found that silencing circHelz remarkably abolished the increased level of circHelz in AngII-infused mice (Fig 3, B). Similarly, Masson's trichrome staining data affirmed that the AngII treatment-induced elevation in fibrosis levels was ameliorated by deletion of circHelz (Fig 3, C). Moreover, heart weight and the mRNA levels of CTGF and α-SMA were significantly increased in the myocardium after AngII stimulation, which was ameliorated by circHelz knockdown (Fig 3, D–F). Silencing circHelz also reversed the increased level of α-SMA induced by AngII, as verified by immunofluorescence (Fig 3, G).
Fig 3Knockdown of circHelz suppresses cardiac fibrosis induced by AngII. (A) Schematic diagram of AngII infusion after circHelz silencing; hearts were harvested at the corresponding time point. (B) The expression level of circHelz in mice after AngII infusion. n = 5 mice per group. ⁎⁎P < 0.01 vs Sham+NC; ##P < 0.01 vs AngII+NC. (C) The collagen deposition in the hearts was stained with Masson trichrome after AngII infusion. Scale bar = 20 μm. n = 4 mice per group. (D) The heart weight in circHelz knockdown mice after AngII infusion. Sham+NC, AngII+NC, n = 6 mice; AngII+sh-circHelz, n = 5 mice. ⁎⁎P < 0.01 vs Sham+NC; #P < 0.05 vs AngII+NC. (E) The mRNA expression level of CTGF in mice after AngII infusion. n = 5 mice per group. ⁎⁎P < 0.01 vs Sham+NC; ##P < 0.01 vs AngII+NC. (F) The mRNA expression level of α-SMA in the heart. n = 4 mice per group. *P < 0.05 vs Sham+NC; #P < 0.05 vs AngII+NC. (G) Representative immunofluorescence diagram of α-SMA expression induced by AngII stimulation. Scale bar = 20 μm. n = 4 mice per group.
Because the antifibrotic effects of silencing circHelz were demonstrated by the above results in the in vivo models of MI and AngII infusion, we then explored the effect of silencing circHelz in TGF-β-treated CFs. We employed small interfering RNA targeting circHelz (si-circHelz) to inhibit its expression and discovered that si-circHelz did not change the level of Helz (Fig 4, A, Supplementary Fig 3, A). Knockdown of circHelz suppressed the increased cell viability and migration induced by TGF-β in CFs (Fig 4, B–D). In addition, our data confirmed that CFs exhibited higher production of collagen, extracellular matrix and cardiac fibrosis markers after TGF-β and NC treatment, as indicated by increased Col-1, CTGF and α-SMA mRNA expressions, which were mitigated by inhibition of circHelz (Fig 4, E–G). Furthermore, EdU assay and immunofluorescence results showed that circHelz deficiency impeded the proliferation and fibroblast-to-myofibroblast transition of CFs activated by TGF-β (Fig 4, H and I). Collectively, these results indicate that downregulation of circHelz is beneficial for inhibiting CFs activation.
Fig 4CircHelz deletion restrains the activation of CFs induced by TGF-β. (A) qRT‒PCR verified the transfection efficiency of si-circHelz in CFs obtained from neonatal mice. n = 5 individual experimental replicates. ⁎⁎P < 0.01 vs NC. (B) Cell viability was detected by CCK-8 assays in CFs obtained from neonatal mice. n = 6 individual experimental replicates. ⁎⁎P < 0.01 vs NC; ##P < 0.01 vs TGF-β+NC. (C and D) The migration ratio in CFs obtained from neonatal mice. Scale bar = 100 μm. n = 4 individual experimental replicates. *P < 0.05 vs NC; #P < 0.05 vs TGF-β+NC. (E and F) The mRNA expression levels of fibrosis-related genes in CFs obtained from neonatal mice. n = 6 individual experimental replicates. ⁎⁎P < 0.01 vs NC; ##P < 0.01 vs TGF-β+NC. (G) PCR analysis of the mRNA level of CTGF in CFs obtained from neonatal mice. n = 5 individual experimental replicates. ⁎⁎P < 0.01 vs NC; #P < 0.05 vs TGF-β+NC. (H) Cell proliferation was detected with an EdU assay in CFs obtained from neonatal mice. Scale bar = 100 μm. n = 4 individual experimental replicates. ⁎⁎P < 0.01 vs NC; #P < 0.05 vs TGF-β+NC. (I) Immunofluorescence analysis of α-SMA expression (green) in CFs obtained from neonatal mice. DAPI (blue) was used to stain nuclei. Scale bar = 20 μm. n = 4 individual experimental replicates (Color version of figure is available online.)
According to the above experimental data, a question that came to mind was whether forced expression of circHelz in CFs would elicit the phenotypes of TGF-β treatment. To clarify this issue, we employed an adenovirus to overexpress circHelz (circHelz-V) in vitro. qRT‒PCR results verified that the expression of circHelz was dramatically upregulated in CFs infected with adenovirus, which did not affect the level of linear Helz (Fig 5, A, Supplementary Fig 3, B). Additionally, overexpression of circHelz significantly promoted the activation of CFs, as manifested by an enhancement in cell viability, migration and fibrosis marker mRNA levels (Fig 5, B–G). Additionally, circHelz markedly increased the proliferation and fibroblast-to-myofibroblast transition of CFs (Fig 5, H and I). In all cases, circHelz overexpression causes adverse variations that mirrors the features of TGF-β-treated CFs.
Fig 5CircHelz promotes the activation of CFs obtained from neonatal mice. (A) Relative circHelz expression after transduction with circHelz adenovirus (circHelz-V) or NC adenovirus (NC-V) in CFs obtained from neonatal mice. n = 6 individual experimental replicates. ⁎⁎P < 0.01 vs NC-V. (B) Cell viability was detected via CCK-8 assays in CFs obtained from neonatal mice. n = 6 individual experimental replicates. ⁎⁎P < 0.01 vs NC-V. (C and D) Migration was analyzed using wound healing experiments in CFs obtained from neonatal mice. Scale bar = 100 μm. n = 4 individual experimental replicates. ⁎⁎P < 0.01 vs NC-V. (E) to (G) The mRNA expression levels of fibrosis-related genes after transduction with circHelz adenovirus in CFs obtained from neonatal mice. n = 5 individual experimental replicates. ⁎P < 0.05, ⁎⁎P < 0.01 vs NC-V. (H) Cell proliferation was detected with an EdU assay in CFs obtained from neonatal mice. Scale bar = 100 μm. n = 4 individual experimental replicates. ⁎⁎P < 0.01 vs NC-V. (I) Immunofluorescence analysis of α-SMA expression (red) in CFs obtained from neonatal mice. DAPI (blue) was used to stain nuclei. Scale bar = 50 μm. n = 4 individual experimental replicates (Color version of figure is available online.)
Therefore, we hypothesized that the increased level of circHelz was related to the regulation of transcription factors in vivo and in vitro under pathological conditions. First, we demonstrated that the expression of Helz was significantly increased in MI mice and TGF-β-treated CFs (Fig 6, A and B). JASPAR
(http://jaspar.genereg.net/) was used to predict the potential transcription factors that can bind to the promoter of Helz. The results revealed 12 putative NFATc2-binding sites in the Helz promoter, and we selected the first 4 binding sites for the following study (Fig 6, C, Supplementary Fig 4, A). In addition, the mRNA and protein levels of NFATc2 were both upregulated and positively correlated with Helz expression in MI and activated CFs (Fig 6, D and E, Supplementary Fig 4, B and C). According to the predicted results, 4 primer pairs were designed to execute ChIP assays, and the results confirmed that NFATc2 could directly interact with the Helz promoter (Fig 6, F). Next, a dual-luciferase reporter gene assay was applied to further elucidate the regulatory mechanism between Helz and NFATc2. These data revealed that the regulation of Helz level was determined by potential NFATc2 binding sites in Helz located between -1783 and -1777 bp (Fig 6, G). Moreover, inhibition of NFATc2 conspicuously decreased Helz and circHelz expressions (Fig 6, H, Supplementary Fig 4, D and E). Transfection of cultured CFs with the NFATc2 overexpression plasmid upregulated the levels of Helz and circHelz (Fig 6, I, Supplementary Fig 4, F and G). Altogether, these results illustrate that NFATc2 serves as a transcriptional activator of circHelz.
Fig 6NFATc2 facilitates the expression of circHelz. (A) The mRNA expression level of Helz in mice. n = 5 mice per group. ⁎⁎P < 0.01 vs Sham. (B) The mRNA expression level of Helz in CFs obtained from neonatal mice. n = 8 individual experimental replicates. *P < 0.05 vs Ctrl. (C) The predicted potential binding sequence between NFATc2 and the Helz promotor region was obtained using the online transcription factor prediction software JASPAR. (D) The NFATc2 protein expression level in MI mice. n = 4 mice per group. ⁎⁎P < 0.01 vs Sham. Protein expression was normalized to GAPDH expression. (E) Western blot analysis of NFATc2 in TGF-β-treated CFs obtained from neonatal mice. n = 4 individual experimental replicates. *P < 0.05 vs Ctrl. (F) ChIP‒qPCR was performed to analyze the binding of NFATc2 to the Helz promoter. IgG was used as a negative control. n = 4 mice per group. *P < 0.05, ⁎⁎P < 0.01 vs IgG group. (G) Relative luciferase activity was detected in CFs obtained from neonatal mice cotransfected with a luciferase reporter plasmid containing the Helz promoter sequence and a NFATc2 overexpression plasmid. n = 3 individual experimental replicates. *P < 0.05, ⁎⁎P < 0.01 vs NC. (H) PCR analysis of Helz and circHelz RNA levels after transfection with NC or si-NFATc2 in CFs obtained from neonatal mice. n = 5 individual experimental replicates. *P < 0.05, ⁎⁎P < 0.01 vs NC. (I) Relative Helz and circHelz RNA levels after transfection with NC or NFATc2 plasmids in CFs obtained from neonatal mice were analyzed by qRT‒PCR. n = 5-6 individual experimental replicates. *P < 0.05 vs NC.
To investigate the mechanism, we used RPISeq (http://pridb.gdcb.iastate.edu/RPISeq/) to screen the proteins that might combine with circHelz. The data confirmed that 2 isoforms of YAP1 (YAP1 isoform 1 and YAP1 isoform 2), which participate in proliferation, differentiation and migration,
had strong interaction probabilities with circHelz, and the predicted scores were 0.75 and 0.8, respectively (Supplementary Fig 5, A). Western blot analysis demonstrated that silencing circHelz reduced the increased YAP1 protein level in MI mice and TGF-β-treated CFs; however, overexpression of circHelz elicited increased YAP1 protein level, which mimicked the effect of TGF-β stimulus in vitro (Fig 7, A–C). Additionally, a YAP1 antibody precipitated a substantial amount of circHelz (Fig 7, D). It has been reported that as long as YAP1 is translocated into the nucleus, it can exert its function.
Dramatically, the distribution pattern of YAP1 was found to be regulated by circHelz; YAP1 was mainly located in the nucleus under TGF-β stimulation, while deletion of circHelz reversed its distribution (Fig 7, E). Moreover, circHelz overexpression facilitated the nuclear accumulation of YAP1 (Fig 7, F). Western blotting results also confirmed that the level of YAP1 was decreased in the cytoplasmic fraction and increased in the nuclear fraction after TGF-β treatment, while downregulation of circHelz abrogated this distribution of YAP1 (Fig 7, G and H). These data suggest that circHelz interacts with YAP1 and promotes its nuclear translocation.
Fig 7CircHelz interacts with YAP1 and promotes its nuclear translocation. (A) The protein expression level of YAP1 in MI mice. n = 5 mice per group. ⁎⁎P < 0.01 vs Sham+NC; ##P < 0.01 vs MI+NC. (B) Western blot analysis of YAP1 in TGF-β-treated CFs obtained from neonatal mice. n = 5 individual experimental replicates. ⁎⁎P < 0.01 vs NC; ##P < 0.01 vs TGF-β+NC. (C) YAP1 protein expression level was detected by western blotting in circHelz adenovirus-treated CFs obtained from neonatal mice. n = 6 individual experimental replicates. ⁎⁎P < 0.01 vs NC-V. (D) RIP assay was performed to detect the enrichment of circHelz using a YAP1 antibody. n = 5 individual experimental replicates. *P < 0.05 vs IgG. (E) The nuclear/cytoplasmic ratio of YAP1 fluorescence was examined via immunofluorescence in CFs obtained from neonatal mice. Scale bar = 10 μm. n = 4 individual experimental replicates. ⁎⁎P < 0.01 vs NC; ##P < 0.01 vs TGF-β+NC. (F) Immunofluorescence was used to detect the nuclear/cytoplasmic fluorescence ratio after circHelz overexpression in CFs obtained from neonatal mice. Scale bar = 10 μm. n = 4 individual experimental replicates. *P < 0.05 vs NC-V. (G and H) Relative cytoplasmic or nuclear expression of YAP1 protein was analyzed by western blotting in CFs obtained from neonatal mice. n = 5 individual experimental replicates. *P < 0.05, ⁎⁎P < 0.01 vs NC; #P < 0.05, ##P < 0.01 vs TGF-β+NC.
CircHelz induced the activation of CFs by targeting YAP1
We speculated that YAP1 might mediate the activation of CFs induced by circHelz. To confirm this notion, small interfering RNA targeting YAP1 was synthesized to conduct functional experiments in CFs. The efficiency of siYAP1 for YAP1 knockdown was verified by qRT‒PCR and western blotting (Supplementary Fig 5, B and C). Uniformly, inhibition of YAP1 blocked the transition from fibroblasts to myofibroblasts, which was activated by circHelz overexpression in vitro, as reflected by the significant decreases in cell viability and the mRNA levels of fibrotic markers (Fig 8, A–D). Meanwhile, transduction with circHelz-overexpressing adenovirus alone promoted the proliferation and migration of CFs, but the detrimental effects were countered by cotransfection with YAP1 siRNA, which resulted in substantial decreases in the wound healing rate and the number of EdU-positive cells (Fig 8, E–G). Furthermore, the fluorescence intensity of α-SMA was reduced after YAP1 silencing in circHelz-overexpressing neonatal CFs (Fig 8, H). Therefore, the results suggest that the activation of cardiac fibroblasts by circHelz is mediated through YAP1.
Fig 8CircHelz regulates CFs activation by targeting YAP1. (A) Cell viability was examined with CCK-8 assays in CFs obtained from neonatal mice after transfection with si-YAP1 and circHelz adenovirus (circHelz-V). n = 6 individual experimental replicates. ⁎⁎P < 0.01 vs circHelz-V+NC. (B–D) The mRNA expression levels of fibrosis-related genes in CFs obtained from neonatal mice. n = 5 individual experimental replicates. *P < 0.05, ⁎⁎P < 0.01 vs circHelz-V+NC. (E and F) Migration was analyzed via wound healing assays in CFs obtained from neonatal mice. Scale bar = 200 μm. n = 4 individual experimental replicates. ⁎⁎P < 0.01 vs circHelz-V+NC. (G) EdU assay analysis of cell proliferation in CFs obtained from neonatal mice. Scale bar = 100 μm. n = 6 individual experimental replicates. ⁎⁎P < 0.01 vs circHelz-V+NC. (H) Representative immunofluorescence diagram of α-SMA expression in CFs obtained from neonatal mice. Scale bar = 20 μm. n = 4 individual experimental replicates.
The following crucial results were obtained from this study: (1) CircHelz was found to be upregulated in cardiac fibrotic tissue and TGF-β-treated CFs. (2) Inhibition of circHelz suppressed cardiac fibrosis in MI mice and activation in CFs, but circHelz overexpression promoted fibroblast-to-myofibroblast transition, proliferation, collagen production and deposition. (3) NFATc2, a transcription factor that regulates gene expression in cardiac disease, upregulated the level of circHelz. (4) The profibrotic effect of circHelz was mediated by binding to YAP1 and facilitating its nuclear translocation.
CircRNAs have a stable nature, abundant expression, high conservation and tissue specificity.
In recent years, an increasing number of studies have found that circRNAs play an important role in cardiovascular diseases, including atherosclerosis, coronary heart disease, cardiomyopathy, atrial fibrillation, heart failure and valve calcification.
However, the role of circRNAs in regulating cardiac fibrosis has not been fully elucidated. Here, we revealed that circHelz was increased in MI and AngII infusion mice and in CFs in response to TGF-β stimulus. Subsequently, the expression of circHelz was inhibited in vivo and in vitro by AAV9 and siRNA, respectively, to conduct functional studies. We found that deletion of circHelz mitigated MI and AngII-induced myocardial injury and fibrosis, as reflected by the improvement in cardiac function and reduction in heart weight-to-body weight ratio, fibrotic area, collagen deposition and the conversion of fibroblasts to myofibroblasts. Conversely, overexpression of circHelz aggravated cardiac fibroblast activation.
Although many studies have reported that circRNAs are upregulated in cardiovascular disease, only a few have explained the reason for this phenomenon. Based on a variety of studies, it is now well established that NFATc2 is most abundantly expressed in the heart
and in skeletal muscle cells and regulates cardiac fibroblasts and the expression of osteolysis-associated molecules as a direct regulatory transcription factor.
In our data, using JASPAR, we predicted that NFATc2 could bind to the Helz promoter; moreover, luciferase reporter and ChIP assays confirmed this interaction. We also confirmed that NFATc2 might act upstream of circHelz because silencing NFATc2 decreased the level of circHelz; conversely, NFATc2 upregulated the expression of circHelz. Consequently, NFATc2 was found to act as a transcription factor to promote the expression of circHelz.
Most circRNAs are thought to sponge miRNAs and interact with RNA-binding proteins to regulate protein levels and encode proteins.
Our previous study demonstrated that circHelz activates the NLRP3 inflammasome by sponging miR-133a-3p, thereby aggravating pyroptosis and cardiac dysfunction in MI mice.
Currently, few reports have explored the interactions between circRNAs and proteins as the mechanism of action in cardiovascular diseases. To further explore the mechanism by which circHelz regulates cardiac fibrosis, we used RPISeq to screen for proteins that could bind to circHelz. According to the database results, YAP1 has a strong ability to bind circHelz. YAP1 is widely involved in human development, growth, DNA repair, and endogenous homeostasis; additionally, activated YAP1 can promote tissue proliferation, differentiation, and regeneration. It has been reported that forced expression of YAP1 abolishes the anti-fibrotic effect of melatonin in lung fibroblasts.
YAP1 was demonstrated to promote lung fibrogenesis by transcriptionally activating Twist via interaction with TEAD, which was conferred by miR-15a loss.
In the present study, RIP and western blotting assays confirmed that circHelz could bind to YAP1 directly and controlled its expression. Since YAP1 must enter the nucleus to play its role in promoting growth and proliferation, we examined the cellular distribution of YAP1 and found that inhibition of circHelz changed the response of TGF-β induced increased localization of YAP1 in the nucleus, while overexpression of circHelz promoted YAP1 translocation to the nucleus. Moreover, to explore whether YAP1 is a key factor in circHelz-induced cardiac fibroblast activation, we conducted a cointervention experiment with circHelz and si-YAP1 and found that silencing YAP1 abolished the detrimental effects induced by circHelz in vitro, suggesting that circHelz targets YAP1 and regulates its location to promote cardiac fibrosis.
This research has the following shortcomings: (1) Other factors that might contribute to the circHelz upregulation and loop in MI mice were not excluded. (2) In addition to YAP1, circHelz might also interact with other proteins or RNAs to regulate myocardial fibrosis. (3) circRNAs are widely used as biomarkers in various diseases because of their stability; however, we did not examine the expression of circHelz in patients with cardiovascular disease. These questions still need to be explored in future research.
The present findings provide evidence that NFATc2 acts as a transcriptional activator to promote the high expression of circHelz in MI and AngII infusion mice and in activated myocardial fibroblasts stimulated by TGF-β. Upregulation of circHelz boosted cardiac fibrosis through binding to YAP1 and facilitated YAP1 localization in the nucleus (Fig 9). These results provide a novel perspective on the role of circRNAs in cardiac fibrosis injury and suggest that circHelz may be a novel target for the prevention and treatment of myocardial fibrosis injury.
Fig 9Graphical abstract illustrating the function of circHelz in cardiac fibrosis. CircHelz accelerates the activation of CFs after MI and AngII infusion, contributing to the development of cardiac fibrosis. The data revealed that NFATc2 binds to the Helz promoter and promotes the transcription of circHelz, thereby facilitating the transfer of YAP1 from the cytoplasm to the nucleus.
Baofeng Yang, Yu Bian, Ning Wang and Ping Pang supervised and designed the research. Ping Pang, Wei Si, Han Wu, Chunlei Wang, Kuiwu Liu, Yingqiong Jia, Yang Yang and Yuting Xiong performed all experiments. Yu Bian, Ping Pang and Wei Si wrote the manuscript. Xue Kong, Zhengwei Zhang, Feng Zhang, Jie Lian, Weitao Jiang, Jinglun Song and Linghua Zeng collected and analyzed the data.
ACKNOWLEDGMENTS
Conflicts of Interest: All authors have read the journal's policy on disclosure of potential conflicts of interest and have none to declare.
This work was supported by research grants from the National Natural Science Foundation of China (Nos. 82104168 and U21A20339), the China Postdoctoral Science Foundation (Nos. 2021M693832), and Heilongjiang Province Postdoctoral Science Foundation (Nos. LBH-Z20174).
DKK3 overexpression attenuates cardiac hypertrophy and fibrosis in an angiotensin-perfused animal model by regulating the ADAM17/ACE2 and GSK-3beta/beta-catenin pathways.
00023-3&id=gr1.jpg){kind=link}
00023-3&id=gr2.jpg){kind=link}
00023-3&id=gr3.jpg){kind=link}
00023-3&id=gr4.jpg){kind=link}
00023-3&id=gr5.jpg){kind=link}
00023-3&id=gr6.jpg){kind=link}
00023-3&id=gr7.jpg){kind=link}
00023-3&id=gr8.jpg){kind=link}
00023-3&id=gr9.jpg){kind=link}